rs2111042 chr17:67158118 G>C
- Sequence
aattttacaaattttaaccatgaa[G/C]tatgtatatttaagcacatttaca
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.02 | 0.78 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Brain_Cerebellum, Cells_Cultured_fibroblasts, Nerve_Tibial, Pancreas, Pituitary, Spleen, Stomach