rs2111568 chr16:49464950 G>C
- Sequence
gcacatagagtgttcagaaaagag[G/C]ggggaatgagacacagtcaggtga
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) GM17942 (lymphoblastoid cell)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12890 (Lymphoblastoid Cell Lines) | 1.95 | -1.95 | 1.00 | |||
| GM17942 (lymphoblastoid cell) | 2.11 | -3.55 | 1.33 |
Items per page:
1 – 2 of 2