rs2111778 chr14:76128369 A>G
- Sequence
acagggctgtgctcagtaaatgtc[A/G]gctgttataattttacccagtttg
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines) GM19239 (male B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02610 (Lymphoblastoid Cell Lines) | -1.70 | 2.17 | 1.00 | |||
| GM19239 (male B-cells lymphoblastoid cell line) | 2.27 | -2.27 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Esophagus_Muscularis, Skin_Sun_Exposed_Lower_leg