rs211184 chr6:96626899 C>G
- Sequence
cgattttttaaaaaaaaaagtaaa[C/G]gtatggtttattctttgaattatc
- ASB in cell types
- hepatocytes Kelly (neuroblastoma) GM17942 (lymphoblastoid cell) neural progenitors
- ASB for transcription factors
- RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | 1.09 | 0.23 | 1.85 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Heart_Left_Ventricle, Nerve_Tibial, Thyroid