rs2112702 chr5:169702037 C>T
- Sequence
cactagaggatgaaaattaaatga[C/T]ttttaatgtcgagaaaaacatggc
- ASB in cell types
- A549 (lung carcinoma) GM02255 (Lymphoblastoid Cell Lines) SK-N-SH (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 0.17 | 1.02 | 2.00 | |||
| GM02255 (Lymphoblastoid Cell Lines) | 1.25 | -0.97 | 1.00 | |||
| SK-N-SH (neuroblastoma) | 0.36 | 1.15 | 1.00 |
Items per page:
1 – 3 of 3