rs2112905 chr5:58188480 C>T
- Sequence
aggaatgtgcttaatcatatcaag[C/T]gatctgatactcaaacctttgtct
- ASB in cell types
- A549 (lung carcinoma) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 0.77 | 0.31 | 2.01 | |||
| foreskin keratinocyte | 2.04 | -5.04 | 2.17 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP college completion, longstanding arthritis, rheumatoid arthritis, stabilized warfarin dose, total cholesterol, years of education