rs2114039 chr4:54226459 T>C
- Sequence
tccctacccttttctcccaacttc[T/C]cggcccggctcaattcgggagttg
- ASB in cell types
- GM23338 neural progenitors
- ASB for transcription factors
- EZH2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EZH2_HUMAN | -0.10 | 1.91 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), aortic valve calcium, corneal curvature, hypertension (early onset hypertension), microalbuminuria
PheWAS acquired absence of breast, acquired hypothyroidism, adverse effects of antibacterials (not penicillins), atrial fibrillation, atrial fibrillation & flutter, atrophy of edentulous alveolar ridge, av block, back pain, benign neoplasm of other parts of digestive system, benign neoplasm of ovary, bronchopneumonia and lung abscess, bundle branch block, cancer of bone & connective tissue, cardiac pacemaker in situ, cardiac pacemaker/device in situ, chronic glomerulonephritis, chronic ischemic heart disease, chronic ulcer of unspecified site, congenital anomalies of intestine, contracture of joint, cysts of the jaws, digestive congenital anomalies, diplopia and disorders of binocular vision, diseases of pulp and periapical tissues, disorders of binocular eye movements, disorders of coccyx, disorders of refraction and accommodation, disorders of the globe, flat foot, fracture of clavicle or scapula, gingival and periodontal diseases, gingivitis, graves disease, hypothyroidism, inflammatory spondylopathies, inguinal hernia, ischemic heart disease, lower gastrointestinal congenital anomalies, macular degeneration, wet, myopia, nonallopathic lesions nec, nonspecific findings on examination of blood, nontoxic uninodular goiter, obstructive sleep apnea, orchitis and epididymitis, other and unspecified disc disorder, other disorders of urethra and urinary tract, pernicious or b12 deficiency anemia, peyronies disease, phobia, polycystic ovaries, precordial pain, primary angle-closure glaucoma, primary pulmonary hypertension, progressive myopia, restless legs syndrome, sacroiliitis nec, secondary malignancy of bone, sinoatrial node dysfunction, sleep apnea, sleep related movement disorders, strabismus (not specified as paralytic), stricture and stenosis of esophagus, symptoms and disorders of the joints, symptoms associated with female genital organs, thoracic neuritis/radiculitis, torticollis, urethral stricture (not specified as infectious), varicose veins of lower extremity, symptomtic, vascular disorders of penis