rs2115107 chr19:7903283 G>A
- Sequence
ggccgtcccctcccccctggcttc[G/A]gccaactctgagcctgctggggct
- ASB in cell types
- MDA-MB-231-1833 (breast cancer cells, bone-tropic metastatic line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDA-MB-231-1833 (breast cancer cells, bone-tropic metastatic line) | -0.59 | 1.68 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cortex, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid