rs2115110 chr5:38193327 C>G
- Sequence
tggtcgtgaatgagcattgccact[C/G]agaggatgtggacgagaacccgcc
- ASB in cell types
- epidermal keratinocytes
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| epidermal keratinocytes | 1.97 | -0.94 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), cystatin c in serum, diastolic blood pressure (dbp), ldl cholesterol, ldl cholesterol change with statins, total cholesterol change with statins