rs2115386 chr19:7196554 C>T
- Sequence
cttgcgcacaaaaatccagtcact[C/T]tgacacttttttgtttgcctccct
- ASB for transcription factors
- CREB1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CREB1_HUMAN | 2.17 | -1.74 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP amyotrophic lateral sclerosis (als), height, homa-b, irritible bowel syndrome, ldl cholesterol change with statins, maternal transmission distortion, rheumatoid arthritis, severe diabetic retinopathy in type 1 diabetes, severe diabetic retinopathy in type 1 diabetes (without nephropathy), tetrology of fallot, total cholesterol change with statins, transmission distortion, urinary albumin-to-creatinine ratio
PheWAS acquired deformities of finger, acquired deformities of limbs, adjustment reaction, adverse effects of cardiac rhythm regulators, adverse effects of opiates and related narcotics in therapeutic use, anxiety disorder, atrophy of edentulous alveolar ridge, benign neoplasm of respiratory and intrathoracic organs, blood vessel replaced, cancer of kidney and renal pelvis, cardiac and circulatory congenital anomalies, cholangitis, chronic kidney disease, stage i or ii, chronic ulcer of unspecified site, clotting factor deficiency, complications of gastrostomy, colostomy and enterostomy, congenital musculoskeletal anomalies, corns and callosities, costochondritis, depression, disturbances of sensation of smell and taste, diverticulosis, endometrial hyperplasia, enthesopathy, esophageal bleeding, extrinsic allergic alveolitis, fibroadenosis of breast, fracture of humerus, gastritis and duodenitis, gastrointestinal complications, genu valgum or varum (acquired), hematemesis, hypercalcemia, impetigo, inflammation of eyelids, lupus erythematosus, menopausal & postmenopausal disorders, mental retardation, mood disorders, nerve root lesions, occlusion of cerebral arteries, with cerebral infarction, other disorders of stomach and duodenum, paralytic ileus, pneumonia, portal hypertension, psychogenic and somatoform disorders, raynauds syndrome, renal cell carcinoma, renal osteodystrophy, respiratory failure, insufficiency, arrest, somatoform disorder, strabismus (not specified as paralytic), stricture and stenosis of esophagus, symptomatic menopause, symptoms involving head and neck, type 1 diabetic peripheral circulatory disorders, type 1 diabetic retinopathy, type 2 diabetic nephropathy, uterine cancer