rs2115569 chr2:215982647 T>C
- Sequence
tactcgaggcaggaagccaataac[T/C]gcttgggaactttgtctttgacca
- ASB in cell types
- breast tumor ZR-75-1 (invasive ductal carcinoma) SU-DHL-1 (Anaplastic large cell lymphoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| breast tumor | -1.94 | 3.28 | 2.00 | |||
| ZR-75-1 (invasive ductal carcinoma) | 1.44 | 0.59 | 1.95 | |||
| SU-DHL-1 (Anaplastic large cell lymphoma) | -1.05 | 1.94 | 1.00 |
Items per page:
1 – 3 of 3