rs211588 chr3:139562349 C>G
- Sequence
agaagcccttcctagagttccaga[C/G]tgattttcctggcactatccgtgt
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) foreskin keratinocyte T47D (invasive ductal carcinoma) GM12891 (male B- cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12890 (Lymphoblastoid Cell Lines) | -1.68 | 1.68 | 1.00 | |||
| foreskin keratinocyte | 0.54 | n/a | 2.33 | |||
| T47D (invasive ductal carcinoma) | 0.49 | 1.17 | 3.15 | |||
| GM12891 (male B- cells lymphoblastoid cell line) | 0.79 | -0.66 | 1.00 | |||
| H929 (plasma cell myeloma) | -1.49 | 1.80 | 1.00 |
Items per page:
1 – 5 of 6