rs2116403 chr9:114080519 A>G
- Sequence
ttgatgttttagttaatgatggta[A/G]tgaggaggtggtagcccccaactt
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | -1.85 | 2.15 | 1.00 | -1.32 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP fasting blood glucose, height, ldl cholesterol change with statins, paternal transmission distortion, rheumatoid arthritis, total cholesterol, total cholesterol change with statins, triglycerides change with statins, waist hip ratio