rs2118506 chr2:127139927 A>G
- Sequence
caaattctaattcctttactcacc[A/G]ctgcttcttgaatctgtagctttc
- ASB in cell types
- esophagus squamous epithelium spleen PC9 (lung adenocarcinoma) epithelial cell of prostate
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| esophagus squamous epithelium | -2.44 | 2.82 | 1.00 | |||
| spleen | 2.67 | -2.54 | 1.00 | |||
| PC9 (lung adenocarcinoma) | 2.56 | -2.18 | 1.00 | |||
| epithelial cell of prostate | 2.42 | -2.26 | 1.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, homa-ir, late onset alzheimers disease
GTEx eQTL Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Spleen, Stomach, Testis, Whole_Blood