rs2118613 chr15:67086069 C>G
- Sequence
accatctgtagttggttatttctg[C/G]tcagaaactcacagtacaaagtgg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.32 | 0.64 | 1.17 | |||
| HEK293 (embryonic kidney) | 0.67 | 0.04 | 1.05 |
Items per page:
1 – 2 of 2