rs2118864 chr4:153649515 A>C
- Sequence
ttttaatttttttttgttaaaaac[A/C]aagacacaaatatacacattagcc
- ASB in cell types
- GM17942 (lymphoblastoid cell) GM19099 (female B-cells Lymphoblastoid Cell Lines) GM02630 (Fanconi anemi)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM17942 (lymphoblastoid cell) | -1.93 | 2.26 | 1.00 | |||
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | 1.11 | -0.91 | 1.00 | |||
| GM02630 (Fanconi anemi) | -0.60 | 0.78 | 1.00 |
Items per page:
1 – 3 of 3