rs2119819 chr12:68560123 G>A
- Sequence
aggaactagaacttcaggcactgc[G/A]taaagccaatggaagccaccctcg
- ASB in cell types
- macrophages form periferal blood EOL-1 (Acute myeloid leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| macrophages form periferal blood | -0.14 | 1.52 | 2.00 | |||
| EOL-1 (Acute myeloid leukemia) | 1.69 | 0.43 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Breast_Mammary_Tissue, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid, Whole_Blood