rs2120095 chr3:112109629 A>G
- Sequence
ggacttcaggtaagagtgtggaac[A/G]ttacattttgctctctttctctgg
- ASB in cell types
- breast tumor xenograft 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| breast tumor xenograft | -0.85 | 2.05 | 1.00 | |||
| 22RV1 (prostate carcinoma) | 2.02 | -0.49 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Heart_Atrial_Appendage, Lung, Nerve_Tibial, Pancreas, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis