rs2124289 chr18:63506267 G>A
- Sequence
ctaggggacattttcattgtcaca[G/A]ctggggtactgtcatctagtggat
- ASB in cell types
- THP-1 (acute monocytic leukemia) KMS-11 (Plasma cell myeloma) erythroid progenitors
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| THP-1 (acute monocytic leukemia) | 1.00 | 0.40 | 1.00 | |||
| KMS-11 (Plasma cell myeloma) | 1.53 | 2.45 | 2.50 | |||
| erythroid progenitors | -4.53 | 2.11 | 2.00 |
Items per page:
1 – 3 of 3