rs2124531 chr12:54368133 C>T
- Sequence
cacagttgacaaacccaggagtcc[C/T]ccattcccctctctttcctgttta
- ASB in cell types
- K562 (myelogenous leukemia) CD14+ monocytes
- ASB for transcription factors
- STAT1_HUMAN TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 1.81 | 0.07 | 3.00 | n/a | No Hit | |||
| TF65_HUMAN | 2.03 | 0.54 | 2.50 | -2.21 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Coronary, Artery_Tibial, Cells_Cultured_fibroblasts, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Thyroid, Whole_Blood