rs2127685 chr2:207848131 A>G
- Sequence
gtttgtgcaaggactcacaaaaac[A/G]aaggccgagcaaataggaagccac
- ASB in cell types
- HepG2 (hepatoblastoma) embryonic stem cells-derived foregut
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.34 | 0.75 | 1.98 | |||
| embryonic stem cells-derived foregut | 2.19 | -1.71 | 1.00 |
Items per page:
1 – 2 of 2