rs2133256 chr11:5684445 A>G
- Sequence
cagtgacaatgacaggactacaga[A/G]ctggacagctgtcacaccatgaag
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM02630 (Fanconi anemi)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.82 | 0.45 | 1.12 | |||
| GM02630 (Fanconi anemi) | 2.14 | -1.99 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Pituitary, Prostate, Testis, Thyroid, Whole_Blood