rs2133979 chr15:70040332 G>C
- Sequence
gagcatttctgcttcctctcctgt[G/C]aatcacctatttatgtcctctacc
- ASB for transcription factors
- PKNX1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PKNX1_HUMAN | n/a | 3.96 | 2.00 | 7.70 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), cystatin c in serum