rs2134095 chr1:165408315 G>A
- Sequence
cattttggaaaccagctcagttag[G/A]actctgttaacaggaaacaagcag
- ASB in cell types
- H929 (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| H929 (plasma cell myeloma) | 3.03 | -5.36 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, diastolic blood pressure (dbp), major depressive disorder and bipolar disorder combined analysis, severe diabetic retinopathy, tetrology of fallot, waist hip ratio