rs2134632 chr12:60704727 G>C
- Sequence
aaaaagtagataagatttattagt[G/C]gacaattctccctgaaacatcata
- ASB in cell types
- LNCaP95 prostate cancer 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP95 | -0.07 | 1.09 | 1.50 | |||
| prostate cancer | 2.25 | -2.01 | 1.00 | |||
| 22RV1 (prostate carcinoma) | 1.54 | -3.86 | 2.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP birth weight, chronic kidney disease, infant head circumference, ldl cholesterol change with statins, total cholesterol