rs2135091 chr18:78161478 A>G
- Sequence
tcctgtcttattagggaaggtcag[A/G]cctgcctctgcttgcaagtgccag
- ASB for transcription factors
- P63_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| P63_HUMAN | 0.72 | 2.33 | 1.00 | -0.03 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP adiponectin levels, comorbid depressive syndrome and alcohol dependence, tourettes syndrome, triglycerides