rs213548 chr2:233832797 G>A
- Sequence
accagggcagagagatgcacctgg[G/A]gaggcctttccaggacgacagcta
- ASB in cell types
- A549 (lung carcinoma) neural cell
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 0.96 | 0.18 | 2.06 | |||
| neural cell | -1.11 | 1.52 | 1.00 |
Items per page:
1 – 2 of 2