rs2136643 chr8:77663826 A>T
- Sequence
catcatgtttacctttccacaaaa[A/T]attacaagtaatgataaaagacaa
- ASB in cell types
- breast tumor 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| breast tumor | 2.66 | -1.87 | 2.00 | |||
| 22RV1 (prostate carcinoma) | 2.48 | -1.70 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP fasting blood glucose, hdl cholesterol, hdl cholesterol change with statins, ldl cholesterol, total cholesterol, years of education