rs2138230 chr14:90060614 G>C
- Sequence
gttctgcatccactacccagatct[G/C]cgcgccctggtgggagcaccgcag
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) HCT-116 (colon carcinoma) GM12878 (female B-cells lymphoblastoid cell line) T47D (invasive ductal carcinoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.86 | 0.85 | 1.18 | -1.27 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Lung, Pituitary, Whole_Blood