rs214088 chr11:17276578 C>G
- Sequence
cccaccaggctccacagcttcggc[C/G]ctcctcaccgcccgcctccaggct
- ASB in cell types
- K562 (myelogenous leukemia) MOLT-4 (Adult T acute lymphoblastic leukemia) primary B-CLL cells HeLa (cervical adenocarcinoma)
- ASB for transcription factors
- BRD4_HUMAN NELFE_HUMAN PRDM9_HUMAN ZN610_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD4_HUMAN | 0.23 | 1.31 | 1.29 | n/a | n/a | |||
| NELFE_HUMAN | -2.71 | 2.64 | 2.00 | n/a | n/a | |||
| PRDM9_HUMAN | 1.68 | -0.80 | 2.00 | n/a | No Hit | |||
| ZN610_HUMAN | -2.35 | 2.66 | 1.00 | 4.42 | Concordant |
Items per page:
1 – 4 of 4
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Whole_Blood