rs2140913 chr7:113087998 C>A
- Sequence
acatggataatagtttgttttttt[C/A]gaaaagaatatacacaaggcacta
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.54 | -0.11 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP infant head circumference, ldl cholesterol change with statins, mitral annular calcium, obesity with early age of onset (age >2), prop taste detection threshold, total cholesterol, total cholesterol change with statins
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid