rs2141864 chr2:102207038 A>C
- Sequence
ccatagccagtgccacagccggcc[A/C]caaggagtactgccagactaccgc
- ASB in cell types
- upper lobe of left lung
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.61 | -0.12 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), aortic valve calcium, diabetic retinopathy in type 2 diabetes mellitus, hdl cholesterol, height, infant head circumference, microalbuminuria, years of education
GTEx eQTL Artery_Aorta, Brain_Nucleus_accumbens_basal_ganglia, Breast_Mammary_Tissue, Esophagus_Mucosa, Muscle_Skeletal, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood