rs2142557 chr22:32207027 G>A
- Sequence
acttgggccaaaaagggaggctgg[G/A]ctttggagggtaggtgtgagtgcc
- ASB in cell types
- MCF7L-P(immortalized breast epithelial cell line) ID00014 (lymphoblastoid cell, DiGeorge syndrome)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7L-P(immortalized breast epithelial cell line) | -0.18 | 1.50 | 1.50 | |||
| ID00014 (lymphoblastoid cell, DiGeorge syndrome) | 1.53 | -0.91 | 1.00 |
Items per page:
1 – 2 of 2