rs2143491 chr20:47599923 G>A
- Sequence
gtgagatatttatggctatcttgc[G/A]caatgcctccagaaatcaatgttt
- ASB in cell types
- JB6 (Human anaplastic large cell lymphoma)
- ASB for transcription factors
- CEBPB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPB_HUMAN | 2.71 | -0.67 | 2.17 | -2.31 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
