rs2143591 chr1:210332725 A>C
- Sequence
tggtgaagcagttttgaaggtttc[A/C]tggcttcattggatagccagtggc
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.71 | -0.09 | 2.02 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Spinal_cord_cervical_c-1, Colon_Sigmoid, Colon_Transverse, Lung, Nerve_Tibial, Pituitary, Testis, Whole_Blood