rs2144279 chr20:62202014 A>G
- Sequence
ggatttaaagagaacccttgtgct[A/G]cgccaggcagttaccgagccgaag
- ASB for transcription factors
- MYOD1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MYOD1_HUMAN | -0.44 | 1.69 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP acute lung injury following major trauma, birth weight, fasting insulin, hdl cholesterol change with statins, homa-b, ldl cholesterol change with statins, obesity with early age of onset (age >2), total cholesterol change with statins
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Tibial, Esophagus_Mucosa, Heart_Left_Ventricle, Liver, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid