rs2144300 chr1:230159169 C>T
- Sequence
agccgtgggaaaggacgctgtacc[C/T]ctgccctattggctgcaccctttg
- ASB in cell types
- HepG2 (hepatoblastoma) LNCaP (prostate carcinoma)
- ASB for transcription factors
- FOXK2_HUMAN FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXK2_HUMAN | -2.19 | 2.58 | 1.00 | n/a | No Hit | |||
| FOXA1_HUMAN | 0.44 | 0.92 | 1.40 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
EMBL-EBI circulating myeloperoxidase levels (serum), hdl cholesterol, hdl cholesterol levels, high density lipoprotein cholesterol levels, triglyceride levels, triglycerides
GRASP coronary artery disease (cad), hdl cholesterol, hdl cholesterol change with statins, major depressive disorder, nicotine dependence (smoking), smoking cessation (nicotine replacement therapy) , nicotine dependence (smoking), smoking cessation (with bupropion hydrochloride), serum myeloperoxidase levels, total cholesterol, triglycerides, years of education