rs214484 chr21:25881968 C>G
- Sequence
agttacacagatgctgtgctccat[C/G]tagccaccaggtggcggtggaaac
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) neutrophils neutrophils from periferal blood GBM39 (Human brain tumor)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.79 | 0.95 | 1.01 | |||
| neutrophils | 3.36 | n/a | 2.00 | |||
| neutrophils from periferal blood | 2.58 | -0.00 | 1.50 | |||
| GBM39 (Human brain tumor) | -3.29 | 1.00 | 2.00 | |||
| HeLa S3 (cervical adenocarcinoma) | 0.75 | 1.11 | 2.00 |
Items per page:
1 – 5 of 5