rs2145010 chr20:15491736 G>A
- Sequence
tggtcctttagacctgccctacat[G/A]tggcaaagtgagctctggccacca
- ASB in cell types
- GM17942 (lymphoblastoid cell) stomach
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM17942 (lymphoblastoid cell) | 2.28 | -1.98 | 1.00 | |||
| stomach | 2.02 | -0.99 | 1.00 |
Items per page:
1 – 2 of 2