rs2145068 chr20:400336 T>C
- Sequence
tattgtgacctgccagattattca[T/C]tcacttagcaattcaacaaccatc
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- P66A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| P66A_HUMAN | 2.46 | -2.18 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, fasting blood glucose, hdl cholesterol change with statins, ldl cholesterol change with statins, parkinsons disease, total cholesterol, total cholesterol change with statins
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid