rs2145154 chr14:68629130 G>A
- Sequence
tcattttagcagtggcccccaggg[G/A]aaatcacaccattcttggttttgt
- ASB in cell types
- T47D (invasive ductal carcinoma)
- ASB for transcription factors
- PRGR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PRGR_HUMAN | 1.23 | 0.40 | 1.29 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP fasting blood glucose, hdl cholesterol, homa-ir, ldl cholesterol, total cholesterol, waist hip ratio
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Cortex, Brain_Hippocampus, Brain_Nucleus_accumbens_basal_ganglia, Esophagus_Gastroesophageal_Junction, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic