rs2145272 chr20:6645571 G>A
- Sequence
gaagtctgtcttgattctaaaaac[G/A]gagaatatttctaaagtaaaatat
- ASB in cell types
- SEM (childhood B acute lymphoblastic leukemia)
- ASB for transcription factors
- RUNX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RUNX2_HUMAN | n/a | 3.04 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI body mass index, fev1, height, lung function (fvc), peak expiratory flow, waist-to-hip ratio adjusted for bmi (joint analysis for main effect and physical activity interaction), waist-to-hip ratio adjusted for body mass index
GRASP age at first tooth, body mass index (bmi), height, lung function, forced expiratory volume in 1 second (fev1), lung function, ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc), microalbuminuria, type 2 diabetes, urinary albumin-to-creatinine ratio, waist hip ratio