rs2145288 chr20:58869154 C>A
- Sequence
cgatcaggtaacctccagattcac[C/A]gccctggtgccccggttctcctgg
- ASB in cell types
- neural cell GM18486 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural cell | -1.31 | 1.82 | 1.00 | |||
| GM18486 (Lymphoblastoid Cell Lines) | -0.12 | 1.64 | 1.00 |
Items per page:
1 – 2 of 2