rs2145814 chr20:21548636 T>C
- Sequence
tagaggacacttctgtttcaattc[T/C]acatccctagggctttggaatatg
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia) Th1-cells
- ASB for transcription factors
- TBX21_HUMAN ETS1_HUMAN SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TBX21_HUMAN | 2.23 | -1.98 | 1.00 | n/a | No Hit | |||
| ETS1_HUMAN | 2.27 | -0.99 | 1.00 | n/a | No Hit | |||
| SPI1_HUMAN | 1.11 | 0.83 | 1.09 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, diastolic blood pressure (dbp), ldl cholesterol, ldl cholesterol change with statins, systolic blood pressure (sbp), total cholesterol, total cholesterol change with statins, years of education
GTEx eQTL Brain_Cerebellum, Cells_Cultured_fibroblasts, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Whole_Blood