rs214697 chr12:47232798 T>C
- Sequence
tctctactcttttagcatcagtac[T/C]tgggggcgtatagattaaactaac
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- ZNF34_HUMAN ZN426_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZNF34_HUMAN | 2.69 | -4.93 | 2.00 | n/a | No Hit | |||
| ZN426_HUMAN | 1.75 | n/a | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), infant head circumference, mitral annular calcium, prop taste detection threshold, pulse rate, resistance to kuru in aged women despite likely exposure, salmonella-induced pyroptosis, stabilized warfarin dose