rs2147797 chr1:201149576 T>A
- Sequence
ctttttatgcacatatggtcataa[T/A]ctctcaacactaggtggcaggata
- ASB in cell types
- foreskin keratinocyte HuCCT1 (intrahepatic cholangiocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | n/a | 0.92 | 2.33 | |||
| HuCCT1 (intrahepatic cholangiocarcinoma) | -0.66 | 1.99 | 2.00 |
Items per page:
1 – 2 of 2