rs2148226 chr13:92897088 A>G
- Sequence
tcattcagagaagatcctttgaca[A/G]ctagtgagatcccaggcactaatt
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines) neural cell
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.09 | 1.26 | 1.56 | n/a | No Hit | |||
| STAG1_HUMAN | 1.39 | 2.21 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, body mass index (bmi), late onset alzheimers disease, spine bone mineral density (bmd), stabilized warfarin dose, total cholesterol