rs2148699 chr1:208094233 T>C
- Sequence
atggttattggggctctagctaga[T/C]gtggctcttccgctggctactttt
- ASB in cell types
- bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| bipolar neuron | -2.24 | 2.60 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, age at death with kuru exposure, lp-pla2 activity, triglycerides change with statins