rs2149144 chr13:105796582 A>C
- Sequence
aattccctctccagtgtatccagc[A/C]ttctctcaatcaccctttcccaga
- ASB in cell types
- 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 1.91 | 0.00 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), hypertension (early onset hypertension), obesity with early age of onset (age >2), resistance to kuru in aged women despite likely exposure, rheumatoid arthritis