rs214959 chr6:152381686 G>A
- Sequence
ttgcctgtggtggattgctcctgt[G/A]aatgattaaacccatatttccctc
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- FOXA3_HUMAN FOXK2_HUMAN RARA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA3_HUMAN | -2.15 | 2.95 | 2.00 | 1.54 | Weak Concordant | |||
| FOXK2_HUMAN | -1.23 | 1.89 | 1.50 | n/a | No Hit | |||
| RARA_HUMAN | n/a | 1.96 | 1.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GRASP age at menarche, alcohol dependence, alcohol dependence (early age of onset), comorbid depressive syndrome and alcohol dependence, hypertension (early onset hypertension), sporadic creutzfeldt-jakob disease